shollix shollix

07-04-2018
Mathematics

contestada

(6.8 x 10^2) x (1.3 x 10^-3) give your answer in standard form

Respuesta :

MissionExam001 MissionExam001

07-04-2018

680 x 0,0013
=68 x 0,013 = 0,884
Hope it helps!
#MissionExam001

Answer Link

crazejb crazejb

08-04-2021

Answer:

8.84x10^-1

Step-by-step explanation:

Thankyou

Answer Link

Otras preguntas

Determine how fast the length of an edge of a cube is changing at the moment when the length of the edge is 5cm and the volume of the edge is decreasing at the

Consider the following reaction. CO2(g) + H2(9) - CO(g) + H2O(1) What is being oxidized? O carbon carbon dioxide oxygen o hydrogen

Which BEST shows how the author of Passage 1 develops the setting in relation to Caroline? blished in 1900, Carrie), a young live with her excerpt from Amid For

Suppose you have two types of customers. Type 1 customers typically purchases your firm's product in bundles of 100 units, while type 2 customers typically purc

An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication

What is the equation of the line that is perpendicular to the line y = 6 and passes through the point (-4, -3)? A.) x=-4.

A 2.5-liter sample of gas is at STP. When the temperature is raised to 546 K and the pressure remains constant, what will be the new volume of the gas?

How was U.S. economic policy toward Japan and China similar during the 19th century? A. The United States prevented both countries from trading with European st

which of Justinian's achievements do you think had the most impact on his empire's greatness

According to Woolf, what factors contribute to a woman's lack of achievement? O A. Not being able to vote in political events O B. Being discouraged from using