cristaltejada8
cristaltejada8 cristaltejada8
  • 06-05-2020
  • Health
contestada

An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​

Respuesta :

iveracisneros98
iveracisneros98 iveracisneros98
  • 06-05-2020

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

Answer Link

Otras preguntas

What other course of studies does math help prepare you for? A Foreign language B Social studies C Science D English
Use the following translation to answer the question below: “Leave your land, your relatives, and your father’s home. Go to the land that I will show you.” Who
There are 30 homes in Neighborhood A. Each year, the number of homes increases by 20%. Just down the road, Neighborhood B has 45 homes. Each year, 3 new homes a
What is the chosen medium of artist dan flavin?
Can you hunt on your own land in colorado
Is social security card capitalized
Which branch of geography is described below? the study of the earth, its features, and how they vary, from mountains, to weather patterns, to climates, to pla
The sum of two numbers is x. If one of the numbers is 12, what is the other? A.12-x B.X-12 C.12+X D.12X
Which of the following don't belong to the kingdoms of the Eukaryota domain? Kingdom Plantae Kingdom Bacteria Kingdom Protista Kingdom Fungi
what is 9967 divided by 100