ZFYRE4579
ZFYRE4579 ZFYRE4579
  • 09-12-2021
  • Mathematics
contestada

9x + 3 – 7x + 4
Help me out please?

Respuesta :

heysdaddias123
heysdaddias123 heysdaddias123
  • 09-12-2021

Answer: The answer is 2x + 7.

Explanation: First, we need to add the numbers:

9x + 3 – 7x + 4

9x + 7 - 7x

And finally, we combine like terms:

9x + 7 - 7x

2x + 7

Answer Link
angelvic angelvic
  • 09-12-2021
the answer is 2x plus 7
Answer Link

Otras preguntas

simplify by using distributive property 3+11(2c+3)
After the party, 4/6 of a pepperoni pizza was left, and 5/7 of a veggie pizza was left. If the leftovers are put together, is there more or less than one whole
Astatine-210 has a half-life of 8.08 days. What fraction of a sample of astatine-210 is left unchanged after 16.16 days?
that delivers oxygen to your body and In the video your blood is compared to a picks up CO2 to be released out when you breath. PLEASE I NEED A ANSWER ​
It cost $510 to get your car fixed. If it was $375 for parts, how much did the mechanic charge for the work to fix your car?
Read the sentence. When Breanna and her sister began baking the cake, she realized they were out of flour. Which correction would make this sentence more clear?
Below is a formula for the volume of a pyramid V = 1/3 Bh , where B is the base area and h is the height Solve the formula for h. What is the height of a pyra
find the measure of all the missing angles.
What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
If you run out of questions on brainly what is another good site to use?