ricorico01 ricorico01
  • 11-11-2020
  • Biology
contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong
  • 19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

What method of organization did the author use? In "The Moon Under Water" by George Orwell A. deductive B. temporal C. emphatic D. spatial
Find the slope of a line given the following points
The conversion of nutrients into energy
Determine whether each statement below describes traditional or modern classification. TRADITIONAL OR MODERN CLASSIFICATION based on similar appearance
What is the gcf of 45 and 9?​
Which name is used to describe organisms that perform photosynthesis tomake their own food?​
Need help finding the length of Ac
What are one of the benefits of an online dictionary
Dominic earns $295 per week plus an 8% commission rate on all his sales. If Dominic sells $4,213 worth of merchandise in one week, how much will his total earni
What is the central idea of the story? My Last Roller Skating Party