nick3227 nick3227

10-06-2021
Mathematics

contestada

Write an equation that
represents each diagram
below and find the value
of the varlable.
10
b.
24
90°
55

Respuesta :

suhailsab974 suhailsab974

16-06-2021

Answer:

by picture?

Step-by-step explanation:

Answer Link

Otras preguntas

help me and I will give brainiest and thanks on profile and rate please and thank you

A car is purchased for $30,000. The value of the car depreciates annually so that it is $24,000 after 1 year, $19,200 after 2 years, and $15,360 after 3 years.

Please help with this

Mr. jay went for a Sunday drive with the family in his monster truck which he calls Big Thunder. He had the cruise control set at 38 miles per hour as they were

. If we share 9 sandwiches with 10 students, how much of a sandwich does each student get? Explain using examples or drawings(Middle schoolMATH) FIRST TO AWNSER

NEED HELP ASAP!!!!! Can someone help me???

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

What will the answers for a ,b and c be

Which of the following correctly isolates the constant for the polynomial: x2 – 12x + 27 A. x^2 – 12x = 27 B. x^2 - 12x = 36 C. x^2 - 12x = -27 D. x^2 + 27 = 12

Refer to the Newsela article “Opinion: From Embarrassed about Bicultural Identity to Celebrating It." Which statements convey an accurate assessment of the auth