RamenDonkey RamenDonkey

14-04-2021
Biology

contestada

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Respuesta :

addysenseheult addysenseheult

14-04-2021

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Answer Link

Otras preguntas

What impact did the Columbian exchange have on the formation of the new world societies

Todd took a math quiz last weak. There were 85 problems on the quiz and Todd answered 20% of them correctly. How many problems did Todd get correct?

4x + 3 < 3x + 6 a. x < 9/7 b. x > 9 c. x < 9 d. x < 3

Troy and Lazetta are solving the following word problem. Rosalie's cat weights 9.8 pounds and her dog weighs 25.4 pounds. What is the weight of both animals com

Recommendation from my plate should be what percentage of grains as whole grains?

What is the domain and range of the set of ordered pairs?

Hoy mantiene stacks of 10 cards if i have 400 cards Draw a pinture

Todd took a math quiz last weak. There were 85 problems on the quiz and Todd answered 20% of them correctly. How many problems did Todd get correct?

A state court that sets a precedent makes a decision that (A) can authorize similar action in the future. (B) can stop similar action in the future. (C) assigns

In mitosis of a single cell, the nucleus A) enlarges B) splits into two. C) splits into four. D) loses half of its chromosomes.