nadiavega nadiavega
  • 08-12-2020
  • Biology
contestada

how are mitosis and meiosis alike and different?

Respuesta :

konnievas
konnievas konnievas
  • 08-12-2020
Cells divide and reproduce in two ways, mitosis and meiosis. Mitosis results in two identical daughter cells, whereas meiosis results in four sex cells.
Answer Link

Otras preguntas

Which is the term for a period of time that a drinker cannot recall
Kukulcan was pictured as a ______???
3x+4=-4×3x solve and show work please :)
Please help me i really need the answer
2x+4y=-12 and -4x-2y=-12 what is the solution
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
what is a production possibility curve
Which of these was a key idea of the Renaissance?
How did Muslims initially treat conquered peoples in India? A. Muslims forbid Indians from participating in trade. B. Muslims stopped Indians from growin
PLEASE HELP, TIMED A survey asked about the number of people who eat breakfast almost every day (B) and the number of people who buy cereal at least once a mont