prosier47 prosier47

08-11-2018
Biology

contestada

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Respuesta :

taylorskyrme taylorskyrme

19-11-2018

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine

Answer Link

Otras preguntas

How should one treat an unjust law?

If you want to stop the the current flow through device 3 in the circuit shown above which one of the following single switches should you open

Bobby’s football team received four five-yard penalties in the first quarter, which meant his team lost yardage in their progress toward the goal line. What was

How to find the value of sin(90+ theta) ?

Lithium-6 has an atomic number of 3. How many neutrons are in this isotope? A. 0 neutrons B. 3 neutrons C. 6 neutrons D. 9 neutrons

The narrator of uncle johns farm is

Given the following chemical reaction:202 CH4 CO2 2 H20What mass of CH4 is required to completely react with 100 grams of O2?

The price of a gallon of gasoline dropped by $0.08 on Wednesday and by 0.25 of that amount on Thursday. Which best represents how the price of a gallon of gasol

if m<1=140, what is m<3?

Can someone please answer. There is one question. There's a picture. Thank you!