annierehmer
annierehmer annierehmer
  • 08-05-2020
  • History
contestada

On edg
In the late 1800s, the focus of the Farmers'Alliances was to organize
1) strong local groups
2) large regional groups.
3) small state groups
4)one large national group.
Help please!!

Respuesta :

bre0114
bre0114 bre0114
  • 08-05-2020
2) large regional groups.
Answer Link
bberg2003
bberg2003 bberg2003
  • 30-11-2020

Answer:

B on ed

Explanation:

Answer Link

Otras preguntas

Sherlock holmes is a far more _____ hero than a character
What’s the correct answer?
What are some negative situations one may get into when they drink too much alcohol? Please answer in full sentences and I will give BRAINLIEST!
I will give you all five stars ⭐⭐⭐⭐⭐
How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG
What is the measure of ∠A? A) 157° B) 159° C) 161° D) 163°
What does angle B equal?
How many atoms are in 0.6 mol of iron? 1. 36.3 atoms 2. 1.08x10^23 atoms 3. 3.91x10^23 atoms 4. 9.26x10^23
Which event(s) occur because the Earth, Moon, & Sun have a 180° alignment (straight angle)?
Even though World War II began 21 years after the end of World War I, some historians believe that the two wars were part of one vast global conflict. Why do yo