Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

can someone help me rewrite this paragraph in their own words "The death penalty gives closure to the victim's families who have suffered so much. Some family m

What is the equation of the given line in standard form? Use integer coefficients. y = -6.9x + 5.1 A. -69x + 10y = -51 B. -69x + 10y = 51 C. 6

What is the above image a photograph of? Why was it created?

Snow is white, and thus has a _______ albedo than bare ground. if global warming decreases snow cover, the resulting change in albedo is likely to _______ furth

The sum of two fractions is 11/12 and their product is 1/6. What is the lesser of the two fractions

Greek culture spread throughout not only Europe, Africa, and Asia but continues today. Explain how we continue to see Greek culture in everyday life. How did th

What kingdom was located in present day Ethiopia and Eritrea?

If 0.4 moles of carbon are allowed to react with 0.6 moles of molecular oxygen, how many moles of CO2 are formed?

Who is j. jayalalithaa?

What is the solar system?