nnalexander10 nnalexander10

07-04-2020
Mathematics

contestada

Helllllllllllllp meeeeeeeee

Helllllllllllllp meeeeeeeee class=

Respuesta :

tmaddie87 tmaddie87

07-04-2020

I believe the answer is A

Answer Link

RickyP2234 RickyP2234

07-04-2020

Answer:

C

Step-by-step explanation:

The points are -15, -10, -5, 20. The farther away the number from zero on a number line, the lower its value is. This is only true on the negative side.

Answer Link

Otras preguntas

Josie bikes 40 miles each month for five months she multiplies 40×5 what unit should she use for the product miles or months?

According to article two of the Articles of Confederation which powers are granted to the states?

please someone help me please??!!

What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Column A Column B voted to boycott trade with the British a. Captain John Parker 1. 2. . location of the militia's arms b. Benedict Arnold sold military informa

Define infant mortality rate..

Identify the most precise name for the angle pair shown in the picture.

When you sweat, what is the external stimuli? I need help asap.

3. You (VOSOTROS) are not going to answer me. Vosotros no a contestarme. Help me

In San Diego, the weather was sunny 90% of the says this past June. How many days was it sunny