Gabrielle2005 Gabrielle2005

09-03-2018
Biology

contestada

What enzyme corrects errors during replication?
DNA polymerase
DNA helicase
DNA ligase
DNA lactase

Respuesta :

Аноним Аноним

09-03-2018

DNA Polymerase proof reads and corrects the bases that are added.

Answer Link

Phatfrmda504 Phatfrmda504

09-03-2018

DNA polymerase the rest is wrong

Answer Link

Otras preguntas

Will has 2 quarters, 6 dimes, some nickels, and 4 pennies. If the ratio of pennies to the total number of coins he has is 1:5, how many nickels are there?

In the experiment, you heated a sample of metal in a water bath and quickly removed and dried the sample prior to inserting it into the cold water "system". Why

In which country was the first to provide social security

Jerry wants to gravel an area represented by a square with side lengths of 3/4ft. What is the area he needs to fill.

The probability distribution of number of televisions per household in a small town is given below. x 0 1 2

if 2500 amounted to 3500 in 4 years at simple interest. Find the rate at which interest was charged

Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC How many bases are in the second fragment?

A fish in a flat-sided aquarium sees a can of fish food on the counter. To the fish's eye, the can looks to be 43 cmcm outside the aquarium. Required: What is

(MC)Why was the creation of the League of Nations included in the Treaty of Versailles? A.to provide a forum for negotiating trade agreements B.to enable the Al

Explain why the rate of photosynthesis in plants is low both at low and high temperatures?