hibob21 hibob21
  • 06-10-2017
  • Mathematics
contestada

What is 0.83% of n is 18.26

Respuesta :

almudena
almudena almudena
  • 06-10-2017
The answer is : 0.151558
Answer Link

Otras preguntas

how do birds keep their lungs filled with oxygenated air
In a Command Economy, __________ makes the basic economic decisions consumers the government supply & demand PLEASE HURRY
To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D
Can anyone teach me?
Evaluate 3x^2-1 when x=2
Help on section E :)
a rectangle has a perimeter of 34 inches the left side is 6 inches long what is the length of the top side
how did life for african americans in the south compare to life for african americans in the north?
Although several different measures of profitability exist, many authorities in the measurement of profitability argue that __________ is the best measurement b
Please help I will reward Brainly