lambobacon8464 lambobacon8464

08-04-2024
Mathematics

contestada

The measure of angle DBE is 0.3x-29 and the measure of angle CBE is 0.2x - 46. Find the value of x.

Respuesta :

Otras preguntas

If a force of 12 N is applied to an object and it accelerates 4 m/s2, what is the mass of the object?

Please help me ASAP!!!

How are dwarf planets and major planets similar? (Choose all that apply) They both travel through space in a path around the Sun. They both have enough mass and

full form of JMD please tell

You are the strategic leader of a highly competitive electronics company, Anderson Inc. Anderson Inc. is a global leader in electronics sales to corporate and

What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Which statement is true regarding the functions on the graph? ° f(2) = g(2) ° f(0) = g(0) ° f(2)= g(0) ° f(0) = g(2)

Pedro's book weighs 19/4 pounds. Blanca's book weighs 17/7 pounds. Use estimation to determine about how much more Perdro's book wweighs than Blanca's. A 1lbs S

Does anyone know the answers to these two? Pls pls tell me if you do, with an explanation if you can, I really need to pass these two question :)

How much refund is due? Tax withheld $3578 and Tax due $2365. A)$3,013 B)$1,213 C)$2,426 D)$5,943