zoeynoel3559 zoeynoel3559

06-07-2017
History

contestada

How did the case marbury vs madison impact the government?

Respuesta :

wellokthen wellokthen

08-07-2017

Marbury vs. Madison was the first Supreme Court Case that used Judicial Review. Which mean the Judiciary Branch can decide wether the act committed is unconstitutional or not.

Answer Link

Otras preguntas

What type of correlation is shown in the graph? A. positive B. negative C. no correlation

The force exerted by a machine is known as ________________.

Can someone tell if this is a run off sentence or is it ok: In comparison of George Washington and Abraham Lincoln, they compare because they were both alive in

To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D

How do you solve it

why are secondary sources often useful

factor the expression 12p-30

Describe ONE result of the decolonization of eastern and southeastern Asia. *This means Asia, not India.

A store is having a 25•/• off sale on all shirts. show two ways to calculate the sale price for a shirt that normally costs $24.

another advantage the British had were thinkers such as Adam Smith who made huge strides and finding out how their economy worked. Which of the following does n