chereegarcia2213 chereegarcia2213

09-09-2022
Mathematics

contestada

3 1/3 divided by 3/8

Enter your answer, as a mixed number in simplest form,in the boxes

Respuesta :

ambero1owilliams ambero1owilliams

09-09-2022

Welp I hope this help

Ver imagen ambero1owilliams

Answer Link

Otras preguntas

In Mrs.Hu's classroom, 4/5 of the students have a dog as a pet. Of the students who have a dog as a pet also have cat as a pet. If there are 45 students in her

What did Dr Martin Luther King jr urge his followers to avoid in his speech at the Holt Street Baptist Church

Find a formula for the shortest distance from a point (a,b,c) to the x-axis. distance

On what was China's economy based during the Tang and Song periods?

The political system of the Persian empire under rulers such as Darius and Cyrus was a?

To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D

How did the cataracts in the bike river make transportation difficult

Me inculparon de crear una cuenta en Facebook y colocaron el barrio donde vivo, ¿cómo podría demostrar lo contrario? Ayuda urgenteeeeeee

Sue was given a gift card for her birthday. When deciding how to spend it, Sue will try to _____. minimize benefits maximize satisfaction increase marginal cos

Based on the information marked in the diagram, FGH and JKL must be congruent. true or false???