robincooper robincooper

10-05-2022
Physics

contestada

What does the value 0.5 cm represent for the wave?

A.) wavelength
B.) amplitude
C.) frequency
D.) equilibrium

What does the value 05 cm represent for the wave A wavelength B amplitude C frequency D equilibrium class=

Respuesta :

akashalmclean akashalmclean

10-05-2022

Answer:

B

Explanation:

The correct answer is Amplitude.

Answer Link

24tphillips 24tphillips

07-08-2022

Your answer is (B) amplitude and the 0.5 cm

Answer Link

Otras preguntas

Write an equation and solve: Twice a number, increased by 3 is 7.

Multiply: (2x2 − 5x)(4x2 − 12x + 10) A) 8x4 − 44x3 + 40x2 − 50x B) 8x4 − 4x3 + 40x2 − 50x C) 8x4 − 44x3 + 80x2 − 50x D) 8x4 − 4x3 − 40x2 + 50x

Why did China and Japan isolate themselves from European trade?

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

What are the "public journals" and why did lee mention them in his August 8th letter?

which of the following is a normal part of a healthy, mature male reproductive system? A) a painless lump or swelling in the testicle B) a change in the way a

witch of the following expression is equivalent to the logarithmic expression below. log(3)5/x^2 A)log(3) 5+2 log(3)x B)log(3) 5-2 log(3)x C)2 log(3) 5-log(3)x

If you can’t take your heart rate a good way to recognize that you’re exercising effeciently is whether or not

0.25,4/5,2/9,0.48 how many cards are greater than 1/2

In the triangular trade route between Europe, Africa, and the Americas, what leg of the route was known as the Middle Passage