Idoeuth Idoeuth

07-03-2022
Mathematics

contestada

In the following system of equations, equations (1) and (3) are used to eliminate y. Which action would be the next appropriate step to solve the system?

In the following system of equations equations 1 and 3 are used to eliminate y Which action would be the next appropriate step to solve the system class=

Respuesta :

11280emmanuel 11280emmanuel

07-03-2022

Answer:

equation 3 and 2then you will be able to solve for x

Answer Link

Otras preguntas

An adequate supply of complements to a product results in: a. more customers opting for the product. b. higher switching costs. c. a significant decrease in sal

When light hits the water droplets in a cloud, the cloud appears white. The light waves are being: A. absorbed. B. scattered. C. intensified. D. consoli

As a bicultural, bilingual, and biracial child, Jose finds himself constantly translating, mediating, and navigating between his Italian American relatives and

The beginning of this roller coaster is at the top of a high hill. If it started from rest at the top of this hill, how high, in meters, above the top of the lo

A 5.4 g lead bullet moving at 261 m/s strikes a steel plate and stops. If all its kinetic energy is converted to thermal energy and none leaves the bullet, what

Heeeeeellllpppppp meee

Accounting Concepts Should we buy stock in a company? Should we extend a line of credit to a company? Should we continue with current operations or change how w

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT -5' produces a polypeptide that

What volume of hydrogen gas is produced when 70.1 g of iron reacts completely according to the following reaction at 25 °C and 1 atm? iron (s) + hydrochloric ac

"Assume your parents have blood types A and B respectively, but you do not know if they are homozygous or heterozygous. At the next family reunion, you get out