lilpeeeeeep999
lilpeeeeeep999 lilpeeeeeep999
  • 07-02-2022
  • Mathematics
contestada

Add x^3 - 4x^2 + 1 to 3x^2 + x
Show Your work!

Respuesta :

DᴀʀᴋPᴀʀᴀᴅᴏx
DᴀʀᴋPᴀʀᴀᴅᴏx DᴀʀᴋPᴀʀᴀᴅᴏx
  • 07-02-2022

[tex]\qquad \qquad\huge \underline{\boxed{\sf Answer}}[/tex]

Let's solve ~

[tex] \qquad \sf  \dashrightarrow \: (x {}^{3} - 4x {}^{2} + 1) + (3 {x}^{2} + x)[/tex]

[tex] \qquad \sf  \dashrightarrow \: {x}^{3} - 4 {x}^{2} + 1 + 3 {x}^{2} + x[/tex]

[tex] \qquad \sf  \dashrightarrow \: {x}^{3} - 4 {x}^{2} + 3x {}^{2} + x + 1[/tex]

[tex] \qquad \sf  \dashrightarrow \: {x}^{3} - {x}^{2} + x + 1[/tex]

Answer Link

Otras preguntas

Need help ASAP!!!!!!
Transitioning from the forming stage to the _________ stage, which is the final stage, requires more than just the passage of time During this last stage, comf
Which expression has the result of applying the distributive property 4(2x - 7)? A) 2x -28 b) 6x - 11 c) 8x - 28 d) 8x - 7
The Constitution has only been amended 17 more times since 1791. Why do you think the writers made the process of adding amendments so complicated
Look at the following Merriam-Webster Online dictionary entry for the word Cleave verb ?
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
the sum of 1/11 and 1/15 is closest to
Which of the following statements is false?
Jane works at The Bottling Company. She needs to put 8,500 bottles of water into cases. So far she has put 2,136 in cases. How many cases can Jane fill with the
How were Native Americans divided by the Revolutionary War?