thejocelynshow1 thejocelynshow1
  • 09-01-2017
  • Social Studies
contestada

The properties of igneous rocks depend on what two factors?

Respuesta :

rene9 rene9
  • 10-01-2017
Rate of cooling and chemistry I believe
Answer Link

Otras preguntas

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
In what major way was us involvement in vietnam different from us involvement in korea?
Need help on this question
What important phenomenon that often plays a role in air pollution episodes is illustrated?
A solution mass of 1 kg is ___ times greater than 100 g, thus one kilogram (1 kg) of a 2.5% ki solution would contain _____ of ki.
Two samples are randomly selected from each population. if a hypothesis test is​ performed, how should you interpret a decision that rejects the null​ hypothesi
What does the presence of similar genes in very dissimilar organisms imply? a the organisms do not share a common ancestor. b the genes became identical through
How does evolutionary change arise
Why did many of the eastern european nations welcome communism and soviet influence after ww ii?
In Act I, scene ii, Claudius’s mention of Fortinbras raises the issue of _____.