choreuangpreepull choreuangpreepull

06-08-2021
Mathematics

contestada

it give f(x) = x-3x⁴ +2x³ -4x² +5x -10 and f(4)(x)?

Respuesta :

divyaprakash2064 divyaprakash2064

06-08-2021

Answer:

f(x) + f(4)

Step-by-step explanation:

TRUST ME DO THIS PROCESS

Answer Link

Otras preguntas

The Third Estate in France was made up of which of the following groups?Here are the optionsmiddle class known as bourgeoisie nobility peasants clergy urban wor

Katie has increased her weekly runs from four miles to six miles, and she's noticed that her energy levels have decreased since doing so. What should Katie do t

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Need help on this question

Definition: this is the process of organisms adapting to their environments over time.

Plot structures in modern literature A. rarely use traditional dramatic forms. B. often end without a stated resolution. C. frequently omit action and fores

The net ionic equation for the reaction between aqueous sulfuric acid and aqueous sodium hydroxide is ________. a.h+ (aq) + hso4- (aq) + 2oh- (aq) → 2h2o (l) +

Which of the following is equal to the rational expression when x ≠ 5 or -1? [tex] \frac{(x-7)(x+1)}{(x+1)(x-5)} [/tex] a. [tex] \frac{x+1}{x-7} [/tex] b. [tex]

what is it called when the amount of the moons lighted surface seen on earth increases

How would you describe the slice that created the rectangular cross-section on this cake