meowmeowmeow34566 meowmeowmeow34566

07-04-2021
Mathematics

contestada

Which value of x satisfies the equation below? 1/2 (3x + 17) = 1/6 (8x-10)

Choice answers:
A. -61
B -55
C. -41
D-35

Respuesta :

carmen1774 carmen1774

07-04-2021

I think is C,,,,,,,,,,,,,

Answer Link

Otras preguntas

Os valores sao da mesma maneira que as coisas sao?

What is the measure of ACE shown in the diagram below? A) 65 B) 70 C) 60 D) 75

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

I need help with this page (just do one problem from each section to help) thanks!

________ describes the unique sound quality or tone color of a sound.

The combined cost of one advance ticket and one same-day ticket to a show was $50. it is known that 17 advance tickets were sold and 48 same-day tickets were so

Why urbanization occured during the industrial revolution?

What is the molarity of the solution formed by mixing 0.20mol of sodium hydroxide with enough water to make 150 ml of solution?

the selling price of 25/4 kg of apples is rs.400 .at what rate per kg are the apples being sold?

ella wants to use the Communicative property of multiplication to help find the product 5×4. What number sentence can she use?