tiarashurley6 tiarashurley6

12-02-2021
Biology

contestada

which
The mRNA molecule consists of 3 nucleotide segments calledwhich correlate to specific

Respuesta :

babylonwilliam babylonwilliam

12-02-2021

Answer:

codons

Explanation:

Answer Link

Otras preguntas

Please list the degree for angle AOK.

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

#1 in the story i am malala On page 25, what flashback does Malala have? #2 On page 25, what is the meaning of the pencil?

Chocos is a dish made from wheat, sugar, and cocoa. Bertha is making a large pot of chocos for a party. Wheat(w) cost $5 per pound, sugar(s) costs $3 per pound,

I need help with question 3 b-d, I figured out the previous questions but I somehow cant figure the rest out. Is there anybody that could help me with it?May i

A 5.40 mL sample of an H3PO4 solution of unknown concentration is titrated with a 5.000×10−2 M NaOH solution. A volume of 7.02 mL of the NaOH solution was requi

According to the signaling theory of capital structure, firms first use common equity for their capital, then use debt if and only if they can raise no more equ

A Pitot-static probe is used to measure the speed of an aircraft flying at 3000 m. If the differential pressure reading is 3300 N/m2, determine the speed of the

Chlorophyll is the primary green pigment responsibility for plant color the molecule it appears Green because it is their resorts are wavelengths of light excep

Convert the following fractions into decimals