vargslol vargslol
  • 08-02-2021
  • Mathematics
contestada

HELP I’ll give you brainliest
This is timed I have 5 minutes

HELP Ill give you brainliest This is timed I have 5 minutes class=

Respuesta :

kristina444 kristina444
  • 08-02-2021
pretty sure it’s y=(x-5)^2+7
Answer Link

Otras preguntas

PLEASE HELP!!! solve using the substitution method y=4x+6 5x-y=6 Answer choices: (8, 18) (15, 22) (18, 12) (12, 54)
a chemistry student is adding a solid to a liquid in a jar. What would put the student in danger during this experiment
I saved$3,000 dollars last year. I saved $600 in the month of January. What percent of the total amount of money did I save last year in the month of January?
In human beings, which factor determines the arc of an individual? Pairing with the X chromosome b. Genes within the chromosomes c. Number of chromosomes D.
What is the price of a silver chain purchased for 45.00
Which statement describes an advantage of direct democracy over limited democracy
pomoże ktoś bardzo proszę o szybką odpowiedź
what is the difference between a sonnet poem, a free verse poem, a lyric poem and a narrative
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
Anna is planting corn on her farm. What is the area of the cornfield 5/6mi and 1/2 mi