trsbezzy trsbezzy
  • 12-01-2021
  • Mathematics
contestada

What is an equation of the line that passes through the points (6, 4) and (4, 1)

Respuesta :

Stuckonnalex
Stuckonnalex Stuckonnalex
  • 12-01-2021

Answer:

m = -5 / -2 = 2.5

Answer Link

Otras preguntas

Write and expression for 7 divided by c
what might happen if he federal government makes cuts health care spending
solve the system of equations. y - 4x =0 and 3x + 6y=9
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
What's the Ratio of this? Color of socks white black blue brown Number of socks 8 7 5 3 The ratio of black socks to all of the so
A bookstore had 60 copies of a magazine. Yesterday, it sold 1/4 of them. Today, it sold 2/5 of what remained. How many copies does the bookstore have left?
How did the Ottoman Empire contribute indirectly to the start of world war 1
Replace ∗ with a monomial to obtain an identity: (∗− 2m)^2 = 100–40m+4m^2 and (3a+2.5b)^2=9a^2+6.25b^2 + ∗
Why are authoritarian and totalitarian systems considered unlimited governments? A) Those systems protect indivdiual freedoms. B) The government leaders have a
Hey guys please answer this as fast as possible, both if possible and I will give you brainliest Any fake answers will be reported immediately