jamyamallard7 jamyamallard7

06-01-2021
History

contestada

Why would the U.S only want to support Democratic Countries?(short answers please)

Respuesta :

paulmgill23 paulmgill23

06-01-2021

Answer:

fundamental American values as religious freedom and worker rights

Explanation:

also helps create a more secure, stable, and prosperous global arena in which the United States can advance its national interests.

Answer Link

Otras preguntas

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′?

Which statements are true regarding an energy pyramid? The number of producers is greater than the number of primary consumers. The amount of energy at the prim

Present an argument against bioengineering.

Samiyah pushes a cart with 20 newtons of force. The cart weighs 10 kilograms. How quickly does the cart accelerate?

What is commonly referred to as "body language" is actually the observation of___________, or the way gestures and body movements send nonverbal messages.

What effects did Stalin’s rule have on the Soviet Union?

A counterbiasing technique is used with the expectation that two alternative phrasings of the same question will yield a more accurate total response than will

Two events that cannot happen at the same time are called _______________ events.

The branch of psychology that studies the relation between attributes of the physical stimuli and our sensory experience of those attributes is called _____.

_______ is young erythrocyte that is normally found circulating in someones blood