Fezanyirakamerewe Fezanyirakamerewe
  • 09-12-2020
  • Social Studies
contestada

Which is the following is an example of an oxymoron

Respuesta :

maggbaron765
maggbaron765 maggbaron765
  • 09-12-2020

Answer:

One oxymoron example is "deafening silence," which describes a silence that is so overpowering it almost feels deafening, or extremely loud—just as an actual sound would. Oxymorons are often used in everyday conversation and in a breadth of writing, such as literature, poetry, and songwriting.

Explanation:

Hope this helps, good luck!

Answer Link
abdullohorange abdullohorange
  • 07-04-2022

Answer:

Choices???

Explanation:

Answer Link

Otras preguntas

The Aztecs: Should Historians Emphasize Agriculture or Human Sacrifice?
Consider a solution containing 0.100 m fluoride ions and 0.126 m hydrogen fluoride. the concentration of hydrogen fluoride after addition of 5.00 ml of 0.0100 m
For which intervals is the function positive?
Can the sides of a triangle have lengths 6.2, 0.5, and 7.8? yes or no
Describe some problems families face with stereotypes and prejudices.
Please help asap !!!!!!!!
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
A wall is 4 m by 3 m. Which is the correct unit of measurement to use when figuring out how much paint to buy to cover the wall? A. m B. m3
What are the four components necessary for a plant to perform photosynthesis? a.chloroplasts, sunlight, carbon dioxide, and water b. ribosomes, seasons, carbon
Gas hydrates are used ___