shannonwitter shannonwitter

14-11-2020
Mathematics

contestada

If you use 2 cups of sugar for every 3 cups of lemon juice how many cups of sugar do you need for 9 cups of juice

Respuesta :

14-11-2020

Answer:

6 cups of lemon juice

Step-by-step explanation:

Answer Link

Otras preguntas

What is the ultimate source of most energy used by organisms on earth?

Read the text:I must go down to the seas again, to the lonely sea and the sky, And all I ask is a tall ship and a star to steer her by; And the wheel’s kick and

If you have a big difference in temperatures, but it's raining rather than snowing, what conditions must exist?

When a cough occurs,air rattles the vocal cords A)TrueB)False

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Jeff has to get up early to go to school, but he wants to stay up late and watch television. his parents disapprove of him staying up late, but when they go out

Decide if the statement is a cause or is not a cause of the Great Depression: Demand fell after the war Creating social security The Dust Bowl Overproduction D

what is the unit of average atomic mass based on

The triangle has a point of concurrency at P. Find the value of x that would make P the incenter of the triangle. x = Find the value of x that would make P

1. Volunteering is ___________. A: A responsibility of citizenship. B: Not important C: A duty of citizenship. D: A good way to make money. 2. A(n) ___________