cocoatizzy cocoatizzy

11-11-2020
Mathematics

contestada

Answer to this? Only comment if you know!! Thank you :D

Answer to this Only comment if you know Thank you D class=

Respuesta :

11-11-2020

Answer:

a = 35°

Step-by-step explanation:

The angles in a triangle always add up to 180°

∴ 33 + 112 + a = 180

∴a=35°

Answer Link

Otras preguntas

Source: "Mr. Polk's War," A Patriot's History of the United States. Schweikart and Allen, 2002 ENT B: President Spe... Note: In 1844, annexation was negotiated

pls ans the given question

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Estimate how many liters of air you breathe in one year. To calculate your estimate, you must make assumptions. 1. Assume it takes 10 breathes to blow up a ball

Which of the following is an example of a transgenic organism? A) millions of copies of DNA that was amplified by PCR b)The human genome C)Dolly the cloned sh

Why are trade barriers not always effective in accomplishing a country’s intended goal given the global scale and interconnectedness of modern trade?

NEED HELP 25 POINTS ! A special 8-sided die is marked with the numbers 1 to 8. It is rolled 15 times with the results shown in the table. Results 3 4 5 2 7 1 3

Can somebody help please

what is an antibodies , please don't use internet

how many miles of a gas at 100 c does it take to fill a 1.00 l flask to a pressure of 152kPa