christialvarez17 christialvarez17

07-11-2020
History

contestada

What was one major effect of the spread of railroads throughout Great Britain
during the Industrial Revolution?

Respuesta :

Halinaaaa Halinaaaa

07-11-2020

A major effect would include the mass transportation of goods in a reduced time period.

Answer Link

brianserranodiaz98 brianserranodiaz98

27-03-2021

Answer: factories were able to more easily ship manufactured goods to markets across the country

Explanation:

A pex

Answer Link

Otras preguntas

Select the direct object pronoun that best completes this sentence: Ana y Claudia __________ traen. (los manteles) (5 points) Question 12 options: 1) nos 2)

The figure shows the letter M and four of its transformed images—A, B, C, and D: Which of the four images was formed by a reflection of the letter M?

A. What did the G.I. Bill do? How did it affect American families after WWII? (15 points)

The processor relies on which of the following to control the timing of all computer operations?

What is an exception to the general idea that markets lead to an efficient allocation of resources? perfect competition black market imperfect competition unfai

Answer this correctly plz

Describe how to draw the geometric mean in a right triangle

In an essay, explain how the alliteration in "Full Fathom Five" helps convey the atmosphere of the poem. Think about where the poem is set and what is described

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

what is x if the three angles of a triangle are 3x,x,x