stephaniesteward408 stephaniesteward408
  • 07-09-2020
  • Mathematics
contestada

Solve for E E=mc squared m=3 c=6

Respuesta :

Space
Space Space
  • 07-09-2020

Answer:

E = 108

Step-by-step explanation:

Order of Operations: BPEMDAS

Step 1: Define variables

m = 3

c = 6

Step 2: Plug into formula

E = 3(6)²

Step 3: Evaluate

E = 3(36)

E = 108

Answer Link

Otras preguntas

What is the energy brought by electron carrier to the mitochondria used for?
A triangular room has sides of length 3.8 m, 5.1 m, and 5.1 m. What is the area of the room?
What is transmitted by all waves? energy mass matter sound
What are the corrdinates of the pre-image of B'​
how to graph one step linear eqautions
A sales manager at SFB Industries would like sales reps to generate PDF quotes out of Salesforce. What can be used to accomplish this?
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this m
Please help me with this one
water tank containing 496 gallons is 62% full. How many gallons total can the water tank hold? 750
How did the Mughal Empire impact the Traditional religion of Hinduism?