sophiafriend34 sophiafriend34
  • 15-05-2020
  • Biology
contestada


Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74
queenb74 queenb74
  • 15-05-2020
The answer is DNA I know because I know
Answer Link
savitar0291 savitar0291
  • 15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

$4,500, 9%, 3.5 years
Given the formula D = ABC, what is the formula for C? A. C = AD ÷ C B. C = D ÷ AB C. C = AB ÷ D D. C = ABD
In what way did British leaders misunderstand the Revolutionary War? A. They thought they had to win only the good will of the people while they ignored militar
what did the Iroquois most likely think about family?
50 words nibandh on mere jivan ka lakshya
An antiseptic is a substance used to do what?
increase- from 42 acres to 72 acres
The population of Algebraville is 500,000 and growing at 6.25%. How many people will live in Algebraville in 10 years? 20?
Geologist have divided earth history into time unit what are largely based on
725 miles in 8 hours ___ miles per hour