bmunoz5910 bmunoz5910

14-04-2020
Chemistry

contestada

Please need help thank you

Please need help thank you class=

Respuesta :

nathanortiz04no nathanortiz04no

14-04-2020

Answer:

it will be the koala and the water buffalo

Explanation:

Answer Link

Melissavcx Melissavcx

14-04-2020

Answer: The water buffalo & the Koala are both mammals.

Answer Link

Otras preguntas

_____ is treatment in which a trained professional—a therapist—uses psychological techniques to help someone overcome psychological difficulties and disorders,

A passenger train leaves the station 1 hour after a freight train leaves the same station. The freight train is traveling 16 mph slower than the passenger train

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

Which best describes the action that advances the plot of the story? A) David assesses his performance during try-outs, and he thinks he did pretty good. B) Da

a character narrating events to the audience with noone else on stage is an example of an

How do you work this out

A pendulum on earth swings with angular frequency ω. On an unknown planet, it swings with angular frequency ω/ 4. The acceleration due to gravity on this planet

This pair of figures is similar. Find the missing side.

Which expression is equivalent to 13b+23b−56(b+1)? 116b−56 16b+56 16b+1 16b−56

A spring oscillator is designed with a mass of 0.231 kg. It operates while immersed in a damping fluid, selected so that the oscillation amplitude will decrease