hal39 hal39
  • 13-04-2020
  • Mathematics
contestada

Evaluate the factorial expression.
28!
24

Respuesta :

shdhxhxhsh
shdhxhxhsh shdhxhxhsh
  • 13-04-2020
????????????????????
Answer Link

Otras preguntas

Q1. Describe the term "Displacement reaction"
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
A conical candle is to be made from 250 cm3 of wax. If the candle's height is three times its diameter, what radius and height should it have, to the nearest te
What was a cause of the Netherlands rebellion against Spain? A. Massacres by Spanish troops against the Dutch B. Objections over the right to divorce C. Protest
Help me pleaseee!!!!
help pleaseeeee im stuck
In the similar triangles below, what is the length of ? 8 cm 4 cm 2 cm 16 cm plz help quick T-T
Estimate how many liters of air you breathe in one year. To calculate your estimate, you must make assumptions. 1. Assume it takes 10 breathes to blow up a ball
Suppose you have a rectangular flower bed whose area is 24ft^2 . The shortest side is (x-4) feet and the longest side is (2x) feet. Find the length of the short
Write three factors that gave all Greek polis a sense of identity despite their differences.