justinap444 justinap444

07-04-2020
Biology

contestada

Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG

Respuesta :

aleecha107 aleecha107

07-04-2020

Answer:

TTAACGCTAGCGAGCATGGCC

Explanation:

A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.

Answer Link

Otras preguntas

Rene has added toe touches and shoulder stretches to his warm-up routine. These activities are most likely going to improve his body composition flexibilit

Which one of the following statements is most accurate? A. Passive muscle stimulators expend the same amount of energy from your cells as does exercise. B. Wear

A fishing tackle box is 13 inches long 6inches wide and 2 1/2 inches high. What is the volume of the tackle box?

What is the volume of this container?

Compositions that offer illusions of perspective are created through A. the rule of thirds. B. ideas of line and form. C. mixing colors with black.

Why does red cabbage sometimes turn purplish-blue when cut with a knife?

Jellyfish and sponges have _________: specialized venomous cells used for defense and to help capture prey. a.auricles b.nematocysts c.nephridia do) statocysts

When performing rescue breathing, be sure to always ____ the head before performing breaths?

When population growth increases in an area, what is happening to the birth rate and age structure of that population? (Site 1)

What percent of 20 is 36