marissaleegrier
marissaleegrier marissaleegrier
  • 08-06-2016
  • Mathematics
contestada

what is the solution of the equation 3y-5y+10=36
( A) -13
(b) 4.5
(C) 13
(D) 2

Respuesta :

Shaisork
Shaisork Shaisork
  • 08-06-2016
A 
Oh no! Something went wrong while adding your answer
It's too short. Write at least 20 characters to explain it well.
Answer Link
yodevbro
yodevbro yodevbro
  • 08-06-2016
3y-5y+10=36

combine like terms

-2y+10=36

subtract 10 from both sides

-2y = 26

divide both sides by -2

y = - 13

so the answer is a
Answer Link

Otras preguntas

Paper chromatography can separate the components of a mixture of colored dyes because the components have differences in decay mode thermal conductivity
PLS ANSWER! THE WORLD HATES ME!! 0.29999999999 As a fraction
when designing a game who decides what the theme will be?
An example of a historical challenge of STAMIS is
what's the answer????????????????
What was the US Supreme Court's ruling in Bush v. Gore, and what was the basis for its decision?
which of the following was not a contributing factor to the great depression
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
In Act I, scene ii, Claudius’s mention of Fortinbras raises the issue of _____.
19 pts - How do you determine if something is isoelectronic? Which of the following is isoelectronic- O2, F-, Ne, Na Se2-, Br-, Kr, Rb+ I-, Xe, Cs, Ba2+