Ka8marle2TommyK Ka8marle2TommyK

08-06-2016
Social Studies

contestada

There are some restrictions on freedom of assembly and freedom of speech under a ____________ system. capitalist socialist mixed economy communist

Respuesta :

08-06-2016

There are some restrictions on freedom of assembly and freedom of speech under a communist system.

Therefore your answer is D. Communist.

Answer Link

Otras preguntas

a sno-cone machine priced at 139$ is on sale for 20% off , the sale tax is 10

Suppose the civilian noninstitutionalized working age population is 35.9 million in Laborland, 4.4 million are working part time, and 13.19 million are working

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

10 Atom 1 Atom 2 Atom 3 Atoms The atoms show four different elements. Which of the following atoms would be found in the same group of the periodic table? * (1

if n^3=x and n^4=20x , where n>0, what is the value of x?

Segment AB measures 6 cm. Point O is the center of dilation. How long is the image of AB after a dilation with a sale of 3?

Give an explanation for them 1. What is scientific notation? 2. What does it mean to have no solution or many solutions to a problem when solving for x? 3. What

3. Choose the best description of a neap tide. Neap tides happen during winter and summer. Neap tides produce during the highest tides of the month. A neap tide

someone please help me i dont understand how too do these

5c+16.5=13.5+10c solve for c