mony1613 mony1613

07-11-2019
Physics

contestada

You have a mass of 95 kg.
a. What is your weight on Earth?

Respuesta :

OfficialBigDog OfficialBigDog

07-11-2019

Answer:

931.63N

Hope this helps :D

Answer Link

Otras preguntas

In which two ways did Rutherford B. Hayes help the South? He withdrew troops from the South. He married a lady from the South. He appointed a Southerner to

While rolling, a wheel with a diameter of 19/2 ft makes 133 revolutions. Find the distance that is traveled by the wheel. Use 22/7 for π.

Reasonableness use the clues to solve the riddle. I am between 24 and 34. you say my name when you count by twos from zero. You say my name when you count by fi

What is the solution of 6x(squared) = 42?

what effect did spending time with the lotus-eaters have on Odysseus's men

The high temperatures in Montana are recorded for a week. High Temperature Sunday 46°FMonday52°FTuesday51°FWednesday54°FThursday49°FFriday51°FSaturday61°What is

This is the act of casting a ballot for a candidate of your choice in an election

Recall that two angles are complementary if the sum of their measures is 90°. find the measures of two complementary angles if one angle is seventeenseventeen

To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D

Calculate the buoyant force in air on a kilogram of titanium (whose density is about 4.5 grams per cubic centimeter). compare with the weight mg of this much ti