ria2389
ria2389 ria2389
  • 09-04-2019
  • Mathematics
contestada

Plz help!!!!!!!!!!!!!!!

Plz help class=

Respuesta :

tramserran
tramserran tramserran
  • 09-04-2019

Answer:   b) (x - 2)(x + 1)(x + 3) = 0

Step-by-step explanation:

Look at the graph to find the x-intercepts (where the graph crosses the x-axis).

x = 2,       x = -1,      and   x = -3

Rewrite them as factors:

x - 2 = 0,  x + 1 = 0, and  x + 3 = 0

Combine the factors through multiplication:

(x - 2) (x + 1) (x + 3) = 0

Answer Link

Otras preguntas

links will be reportedwhat is the area of the figure​
Which animal is strongest physically. (not compared to their size)
Solve: 2y2+10y=0. can have multiple answers
Can somebody help me with the two spanish questions? If you could that'd be much appreciated!
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
How can playing tennis help you learn how to play pickleball?
Answer both questions in a short response: 1.) Summarize a central idea of a monologue of your choice from Act 3. 2.) How do characters affect the plot in Act
There are ten shirts in your closet, four blue and six green. You randomly select one to wear on Monday and then a different one on Tuesday. You wear a blue shi
What is the sign of the rational number you wrote in part A for Quiana's loan? What does the sign represent?
On Friday, 55% of the students at Wilson Middle School bought a hot lunch and the rest packed their lunch. What fraction of students packed their lunch? Select