10190879 10190879

07-04-2019
Mathematics

contestada

express in trigonometric form PLEASE... -6+6 sqrt. 3i

Respuesta :

zendayaforlife9 zendayaforlife9

07-04-2019

Answer:

6sqrt2(cos(-5pie/4)+isin(-5pie/5))

Step-by-step explanation:

Answer Link

Otras preguntas

Physical proximity tests of the actus reus of attempt focus on

simplify the imaginary number (square root symbol) -8

What wrong with the sentence below He plays offensive line on the football team.

Which of the two substances would have the higher boiling point ch4 or c?

A 2.5% (by mass) solution concentration signifies that there is of solute in every 100 g of solution. 2. therefore, when 2.5% is expressed as a ratio of solute

Suppose a fungus destroys the central xylem and phloem tissues in the roots of a tree. What function of the root system will be lost because of this damage

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Please help please please please

In which of the conditions would oxygen release from hemoglobin be increased?

There is a spinner with 11 equal areas, number 1 through 11. If the spinner is spun one time, what is the probability that the result is a multiple of 5 and a m