jjo14595 jjo14595

09-01-2019
Mathematics

contestada

The price of an mp3 player is reduced to three-fourths of its original price. The new price is $75. Find the original price of the mp3 player.

Respuesta :

knightkita95 knightkita95

09-01-2019

Answer:

The original price of the mp3 player would be $150

Step-by-step explanation:

Answer Link

Otras preguntas

Dodge and Pettit developed a model of how aggressive children process information differently from others. They argue that aggressive children are more likely t

Because it is a "transplant" that can include APCs and T cells from the donor, a bone marrow transplant may induce a very specific type of rejection known as __

Which protozoan has a unique appearance, with a blue halo, when viewed using ultraviolet fluorescence microscopy? Giardia lamblia Cryptosporidium hominis Cyclos

Dehydration synthesis leads to formation of monomers polymers water and polymers none of the above

What is the definition of a hook? A.) an elaborating sentence that provide details or facts B.) a topic sentence that states the main point C.) an extension sen

Why do lunar eclipses typically last much longer than solar eclipses?

At a game show, there are 8 people (including you and your friend) in the front row. The host randomly chooses 3 people from the front row to be contestants. Th

What is the biological vector for African sleeping sickness? mosquito tsetse fly deer tick sand fly

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

All but which one of the following are examples of secondary immunodeficiencies? HIV/AIDS malnutrition chronic granulomatous disease immunosuppression due to me