zamorakayz1234 zamorakayz1234
  • 14-11-2018
  • Mathematics
contestada

What is equivalent to 25x+10x=11

Respuesta :

helloww
helloww helloww
  • 14-11-2018

35x=11 is equivalent and if you want o find a value for x, iw would be x=0.31. 0.31 is a rounded answer, if you want to find what x actually is equal to do 11 divided by 35, and that will get you what x is equal to.

Answer Link

Otras preguntas

Determine if the following is a linear equation. If so, write the equation in standard form. y-3/4 = x/2
a ribbon is 12.3 feet long. another is 3.12 feet shorter than it. what is the total length of the two ribbons?
Tina has 1/2 quart of iced tea. She pours the same amount into each of 3 glasses. Which equation represents the fraction of a quart of iced tea that is in each
38% of adults in the united states regularly visit a doctor". this conclusion was reached by a college student after she had questioned 520 randomly selected me
You transcribed DNA to make and built a sequence of amino acids through
describe how the piece of chalk in this image may be affected by static friction, sliding friction, fluid friction and rolling friction. Which type of friction
how will your health most likely be affected if you follow the recommended guidelines for sleep, rest, and physical activity?A. Energy levels will decrease. B.
what were the mandate musa's contributions to Mali?
Solve for x in the equation x^2-8x+41=0
To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D