chanteldiaw13 chanteldiaw13
  • 08-05-2018
  • English
contestada

According to Stephen King, what is the purpose of horror writing?

Respuesta :

joyellewashingt joyellewashingt
  • 09-05-2018
To temporarily free the imagination.
Answer Link
nikisaphyre13 nikisaphyre13
  • 10-12-2020

Answer:

For the second part on Edge, the answer is B "by making the portrait eerily lifelike"

Explanation:

Got it right on Edge

Answer Link

Otras preguntas

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
The correct sequence of events in the american settlement of texas is:
What is 1/10 of 0.04
what is the best definition of ets reactions
The blue dot is what value on the number line
6. 9 ____= ____ b-1. 7
How did the cold war stall the progress of the un and the genocide convention?
A collaborating government known as the Vichy government worked with German conquerors in what country? A. France B. Italy C. Poland D. Spain
The federal reserve act placed national bank under the control of the
A two-year-old child is on the same level as a ten year old child in terms of conflict resolution. true or false ?