jml2149 jml2149

07-12-2017
Mathematics

contestada

what is the common difference in the sequence 50 40 30 20 10

Respuesta :

Аноним Аноним

07-12-2017

Hello there love
The sequace is taking 10 away
Have a nice day

Answer Link

woodmastersouth woodmastersouth

20-10-2021

Answer:

-10

Step-by-step explanation:

Got it right on the test.

Answer Link

Otras preguntas

What is the past tense of squeeze?

Inducing the loss of fluid in the body in a process called? A. The diuretic effect B. The calorie effect C. The digestive effect D. The thermic effect

A test consists of 10 a. True b. False questions. to pass the test a student must answer at least 9 questions correctly. if a student guesses on each question

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

What monomers are found in DNA and RNA? A-amino acids B-nucleotides C-fatty acids D-saccharides

By the end of 1800s approximately _______ of Chinese were addicted to opium A. 1% B. 15% C. 25% D. 50%

A supervisor spends a day inspecting a nuclear plant for potential radiation leaks. She has to move throughout the plant inspecting all the equipment and machin

Passive immunity in a person is acquired from antibodies produced during infection in that person. a. True b. False

a vacation of five days Which is the correct way to rewrite this phrase? A. five days’s vacation B. five days’ vacation C. five days’es vacation D. fiv

Newspapers derive most of their income from circulation. true or false