coeurenor474 coeurenor474

07-04-2024
Mathematics

contestada

Soit A(5;1) et B(-2;1) deux point dans un repère orthonomé, déterminer les coordonnées du vecteur AB

Soit A51 et B21 deux point dans un repère orthonomé déterminer les coordonnées du vecteur AB class=

Respuesta :

Otras preguntas

To decide whether two triangles are similar is it enough to know that two pairs of corresponding angle measures in the triangle are equal. Explain your answer.

The splitting of a cell into two daughter cells in the eukaryotic cell cycle is

What is the action force and the reaction force when you sit down on a chair

How does did the concept of competition relate to the arms race between the United States and the Soviet Union during the Cold War?

How do I find the slope of a line.

In each pack of Mott’s gummies there are 8 gummies. If Ms. Silverstein eats 15 packs a week, how many gummies does he eat in total?

Simón Bolívar was instrumental in the independence of what nation? A. Brazil B. Haiti C. Mexico D. Columbia

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Which of the following represents a financially responsible decision A. Putting a small amount of money aside each month to use to purchase Christmas gifts B.

Which cloud type consists of globular cloud masses with a cauliflower structure?