vazgeovanna48 vazgeovanna48

09-03-2024
Mathematics

contestada

Give the location of Rome as an ordered pair (x, y). 10 8 London 10 Berlin Paris 6 Madrid 2 SP 10 Bern Rome

Respuesta :

Otras preguntas

What’s simplest form of a^3 +b^2? Need ASAP

Which function allows you to select a part of the photograph while it deletes the non-selected parts? Flip Crop Burn Dodge

Write as a product of 2 binomials and a monomial (factor out as much as possible from each binomial). a. (14x+21y)(6ab–3a) b. (4x–12x2)(16y3+12y2)

15x-3=12 linear equation

The chimney hill neighborhood was surveyed to find out how many televisions sets were in each household. There were a total of 201 sets in the neighborhood and

what is the advantage of having a folded inner membrane in the mitochondria

Why did California vote to get rid of Daylight Savings? I will give brainliest to whoever answers first!!!!!!!!!!!!

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

which is a limit on the way political action committees can raise money when they are branches of labor unions or professional organizations?A. They cannot rais

To Mark or decided to purchase a new DVD player on an installment loan DVD player was $295 Tim agreed to pay $31 per month for 12 months what is the finance cha