jalielbullard0 jalielbullard0
  • 07-12-2022
  • Mathematics
contestada

Which values from the specified set make up the solution set of the inequality? 5w–10>20 ; {5,6,7,8} Select each correct answer. Responses 5 5 6 6 7 7 8 8

Respuesta :

Otras preguntas

Please help me Two cars got an oil change at the same auto shop. The shop charges costumers for each quart of oil plus a flat fee for labor. The oil change f
conclusion about high school should have class were they teach students how to managed their money and to do taxes.
What makes the heart such an efficient, self regulating pump?
T tauri stars are _____ that are approaching the main sequence in age.
Determine the percent ionization of a 0.145 m hcn solution.
Which of the following best describes Dr. Martin Luther king's strategy of protesting
Slope 0; y intercept (0,-7/8)
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
How did the fall of Rome affect trade in Western Europe? A. Roman merchants set up their own successful market centers in Western Europe. B. Frequent wars and
The United States government is divided into three parts known as the executive, legislative, and judicial branches. Each branch of government has powers and re