kennettzone5907 kennettzone5907
  • 10-11-2022
  • Biology
contestada

elow is the coding strand of a small gene that codes for a peptide. assume the gene has a traditional start codon. how many amino acids long is the peptide if we assume traditional start and traditional stop codon? 5' aatccgtatctatgaccgtttggaaacactaagcggtactc 3'

Respuesta :

Otras preguntas

what is the quartic root of 64? And how did you figure it out? I'm really confuse on quartic roots.
About how tall should you be at age 12, about in 7th grade. And how about weight?
how did Pericles change the government of Athens???
Ms. Russell has 24 students in her class. 3/8 of the class went out for recess. 1/4 went to the library. The rest stayed in the classroom.a. What fraction of th
How has technology affected human population growth?
What country did Marco Polo sail for?
The island of corsica which lies south of the ligurian sea is part of what country?
what is the quartic root of 64? And how did you figure it out? I'm really confuse on quartic roots.
About how tall should you be at age 12, about in 7th grade. And how about weight?
Find the unit rate. 6 ounces for 2.5 servings Help! Please