mmt123 mmt123
  • 09-06-2020
  • Social Studies
contestada

Why did the Mughal empire come to a decline??

Respuesta :

danielabardot
danielabardot danielabardot
  • 09-06-2020

Answer: A series of foreign invasions affected Mughal Empire very badly.

Explanation: Attacks by Nadir Shah and Ahmad Shah Abdali, which were themselves the consequences of the weakness of the Empire, drained the Empire of its wealth, ruined its trade and industry in the North, and almost destroyed its military power.

Answer Link

Otras preguntas

How to find the surface area of certain 3 dimensional shapes
What is the process by which populations change over time
What kind of dog is this?
How was Germany's invasion of the Soviet Union similar to Japan's attack on Pearl Harbor?
Identify the slope and y-intercept of the equation Y=-2/3x+490
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the
What is an expression, in simplest form for the perimeter of a triangle which is 3m, 3m, and 3m
Humans can become conditiined to pair certain food flavors with certain events .
For the Transformation T, write the T^-1. T : (x, y) (5x, 5y ) T^ -1 (x, y) (x - 5, y - 5) (5x - 1, 5y - 1) (1/5x, 1/5y)
Yearly tuition, housing, and fees for a local college are $9500, $1500, and $1870 respectively. You have saved $6100 and have a scholarship for $2500. How much